Расшифровка Генома. Базовая информация

Расшифровка генома. Генетический тест
Давайте вначале немного разберемся с терминологией и базовым устройством жизни на планете Земля как таковой.
Итак, любое живое существо функционирует на базе белков. Любой гормон, любой рецептор к нему, любой энзим и даже наш прекрасный суперкомплекс в митохондриях, который производит энергию – это все белки. Нет белков – нет жизни.
Белки – это как роботы, их множество разнообразных, у каждого своя функция. Но эти роботы все состоят из одинаковые деталек – аминокислот. Отличается только набор этих деталек и их последовательность.
 
Аминокислот, в свою очередь, всего лишь двадцать. Часть из них мы получаем строго с едой, они называются незаменимыми. А часть наш организм умеет синтезировать сам.

Как клетка понимает, какую именно последовательность аминокислот нужно соединить в цепочку, чтобы получить конкретный белок?

Верно, из генов.
Точно так же, как вся жизнь на земле состоит из этих двадцати аминокислот, она вся состоит – из генов, которых кодируют их последовательности. Клетке нужно просто прочесть этот код, как рецепт – и реализовать то, что там написано, шаг за шагом, и получится новый белок!

Человеческий геном располагается в хромосомах. Это такие палочки, состоящие из крепко скрученных длинных цепочек ДНК. Удобный метод для хранения и копирования, не более.
У человека без аномалий 46 хромосом. В каждой из них содержится несколько сотен или даже тысяч генов. Общее их количество – около 36-38 тысяч. У женщин чуть больше, потому что Х больше, чем Y
Почти каждый из этих генов кодирует какой-то один конкретный белок. И, соответственно, отвечает за какой-то один конкретный процесс.
 
Как происходит кодирование и чтение? С помощью четырехбуквенной азбуки ДНК.
Вообще, вся ДНК – это последовательность из четырех букв, A, G, C, T (это сокращения от: аденин, гуанин, цитозин, тимин.
Расшифровка генома. Генетический тест
Каждая аминокислота кодируется уникальной только для нее последовательностью из 3 букв. Имея в виду, что из 4 символов можно таким образом получить 61 разную последовательность, для многих аминокислот есть несколько кодов. Один отдельный код отведен на кнопку “начинать чтение здесь!”, а три – на “закончили работу”.
 
Так, например, глицин кодируется аж четырьмя кодами: ССА, CCG, CCT, CCC.
А лизин двумя: AAA и AAG.
Расшифровка генома. Генетический тест
Белки состоят из сотен и даже тысяч аминокислот, поэтому я не буду пытаться приводить хоть какую-нибудь полную формулу на языке ДНК. Смысл в том, что вся эта последовательность закодирована в длиииииинную цепь вот таких вот AAGGTCTCTCAAAGGGTTTCAGAGA, и любая клетка нашего тела умеет этот код читать, производя по нему рабочие белки.
Всего этих букв в человеческом геноме около 3 миллиардов, кстати. В одной клетке!
Расшифровка генома. Генетический тест

Из-за всевозможных влияний на ДНК эта последовательность может изменяться – портиться, теряться и умножаться. Как вы видите из кодов на картинке, иногда одна буква не меняет ничего (обычно последняя в триплете). Но иногда всего одна буква приводит к катастрофам. Например, при болезни под названием амавроз Лебера – это когда ребенок с младенчества медленно теряет зрение и становится слепым – ситуация именно такая. Всего одна буква!!..

Впрочем, обычно из-за одной единственной замены последствия не столь драматичны. В таких случаях как СМА, например (спинальная мышечная атрофия) – это потеря целого небольшого участка гена.

Еще, как вы, может быть, помните, половину ДНК мы получаем как от мамы, так и от папы. Поэтому у нас практически для каждого гена есть его две версии, мамина и папина. Или, по-научному, два аллеля.
И тогда, например одна версия гена может быть здоровой, а другая – “мутационной”. В этом случае у клетки есть вариант, какую версию читать, и обычно она будет стараться читать здоровую.
Но когда вариантов нет или здоровая версия “заглушена” – тогда проявляются проблемы.

Расшифровка ДНК

.

Расшифровка самого первого человеческого ДНК в 2001-м году заняла около восьми лет и стоила миллиард долларов. Сегодня это может сделать любой желающий за 50-100 долларов и несколько недель. Круто, да? И я лично считаю, что не пользоваться этой возможностью – все равно, что продолжать жить без навигатора в 21-м веке.

С помощью ДНК можно узнать не только потенциальные риски передать детям какие-то заболевания (хотя и это тоже важно), но и свои собственные особенности:

На эти и многие, многие другие вопросы можно ответить, заглянув в расшифровку вашего ДНК.

Где сдавать? Лабораторий сейчас много, принципы работы у них плюс-минус одинаковые, поэтому – для начала в любой лаборатории. Грамотнее всего, имхо, будет сдать в сервисе, подобном 23andme, узнать там свое происхождение, а потом скачать оттуда raw data (сырые данные) и прогнать их по базам данных, которые специализируются на анализе ДНК именно с точки зрения здоровья.

Я сама в свое время прошлась по многим из них, и нежнее всего люблю SelfDecode. Так нежно, что недавно решилась-таки на заведение там профессионального аккаунта и теперь все мои клиенты с данными ДНК получают полный их анализ как часть нашей работы (и, надо сказать, им это получается сильно дешевле, чем делать это самостоятельно).

Совсем бесплатно это можно делать самим, пользуясь SNPедией – это как википедия, только по SNP. Я в свое время с нее и начинала.

Расшифровка генома. Генетический тест

SNP - Снип

.
SNP – single-nucleotide polymorphism – однонуклеотидный полиморфизм – это как бы координаты конкретной точки в ДНК плюс варианты букв, которые там могут встретиться. От того, какая в SNP буква, и будет зависеть конкретное влияние работы гена на организм.
 
SNP произносится как “снип”, и так я и буду дальше его называть.
Снип в расшифровке ДНК всегда выглядит как rs и набор цифр.

Снип работы ваших рецепторов к витамину Д (главный, хоть и не единственный)

rs2228570

Если в вашем файле с сырыми данными он выглядит как rs2228570(А;A) – то у вас очень снижена активность этих рецепторов, а значит и уровни витамина Д. У вас ГОМОЗИГОТНАЯ мутация.

Поэтому вам почти гарантированно нужно супплементировать витамин Д дозами побольше, чем тем, у кого rs2228570(G;G) – который означает, что рецепторы работают хорошо.

Если же вы нашли у себя промежуточную версию rs2228570 (A;G) – то у вас что-то между. И это ГЕТЕРОЗИГОТНАЯ мутация. Когда только один аллель – материнский или отцовский – мутантный.

Снип  для синдрома Жильбера

rs34983651 (AT;AT) – это то же самое, что 7/7, т.е. гомозигота. Отсутствие СЖ будет выглядеть как rs34983651 (-;-), а гетерозиготный вариант как (-;АТ), соответственно.

Другие снипы, ассоциированные с СЖ:
rs5839491
rs3064744 (ранее как rs34815109 и rs35600288)
Все из них тоже будут либо (АТ;АТ), либо (-;АТ), либо (-;-).
К сожалению, в стандартных тестах эти снипы бывают крайне редко.

Дополнительная информация

Оставьте комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *